View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11019_low_7 (Length: 244)
Name: NF11019_low_7
Description: NF11019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11019_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 39091427 - 39091640
Alignment:
| Q |
18 |
gttgataagtctgggactaggagaattccaatgggagcacatagtattcacattggtgatgttaaacattttgtatcacttcaagaacaaaaactaggga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39091427 |
gttgataagtctgggactaggagaattccaatgggagcacatagtattcacattggtgatgttaaacattttgtatcacttcaagaacaaaaactaggga |
39091526 |
T |
|
| Q |
118 |
tcaccaagacctgaattcnnnnnnnatggggacgcatttagaatgtcttctaattgatctcaatatatactactaaggtaagtgtataatagatcaatag |
217 |
Q |
| |
|
||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39091527 |
tcatcaagacctgaatt-tttttttatggggacgcatttagaatgtcttctaattgatctcaatatatactactaaggtaagtgtataatagatcaatag |
39091625 |
T |
|
| Q |
218 |
tatgccagggattac |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39091626 |
tatgccagggattac |
39091640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 17 - 87
Target Start/End: Complemental strand, 44714342 - 44714272
Alignment:
| Q |
17 |
agttgataagtctgggactaggagaattccaatgggagcacatagtattcacattggtgatgttaaacatt |
87 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
44714342 |
agttgataaatctgggattaggagaattccaatgggagaacatagtcttcacattggtgatgttaaacatt |
44714272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University