View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1101_high_4 (Length: 444)
Name: NF1101_high_4
Description: NF1101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1101_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 16 - 347
Target Start/End: Complemental strand, 12350767 - 12350452
Alignment:
| Q |
16 |
acgacgatggcggaagaagaggcatggttgagcgcatgagaactgcgcccacataggagtatagcaaccccaaacagggtgaaaagatagcgcggagggg |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12350767 |
acgacgatggcggaagaagaggcgtggttgagcgcatgagaactgcgcccacataagagtatagcaaccccaaacagggtgaaaagatagcgcagagggg |
12350668 |
T |
 |
| Q |
116 |
accttgttgcaccatcactgctctagtctacatggttaagaaagaaattggattttgaaggggagaagtacggcaggtaaggaggaagagagaggtcaga |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12350667 |
accttgttgcaccatcgctgctctagtctacatggttaagaaagaaattggattttgaaggggagaagtacggcaggtaaggaggaagagagaggtcaga |
12350568 |
T |
 |
| Q |
216 |
ggatatggatttagagagattttttggatcatgattgcatgccttcccaagtattagtgtactatgtgcatattagagacgagaaatcattaatcctcca |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| | || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12350567 |
ggatatggatttagagagattttttggatcatgatt-----cctcc----gt-------tactatgtgcatattagagacgagaaatcattaatcctcca |
12350484 |
T |
 |
| Q |
316 |
ttacccaatccaagtcaatcccttgaaatata |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12350483 |
ttacccaatccaagtcaatcccttgaaatata |
12350452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University