View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1101_low_18 (Length: 212)
Name: NF1101_low_18
Description: NF1101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1101_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 15886055 - 15885913
Alignment:
| Q |
1 |
cattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggagagaggggtctccttgccttaaccctctaccagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
15886055 |
cattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggagagaggggtctccttgccttaaccctctaccagga |
15885956 |
T |
 |
| Q |
101 |
ataaaaggaacaggtgtgctaccattaaacaaaatagaataat |
143 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15885955 |
ataaaaggtacaggtgtgctaccattaaacaaaatagaataat |
15885913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University