View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1101_low_9 (Length: 379)
Name: NF1101_low_9
Description: NF1101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1101_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 7 - 91
Target Start/End: Complemental strand, 49419194 - 49419110
Alignment:
| Q |
7 |
gatcatgatgagatactttcgttatatgtctttcagttttttgctttatatgcatttctattatttgctttttaaaattaatatt |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49419194 |
gatcatgatgagatactttcgttatatgtctttcagttttttgctttatatgcatttctattatttgctttttaaaattaatatt |
49419110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 249 - 370
Target Start/End: Original strand, 4967811 - 4967931
Alignment:
| Q |
249 |
gggattgtgggagtagtttattcgtttgtaatgagtgcgctactgtcctaaacaagaattattccacttagaaattgaattgaatttaagttcttccgaa |
348 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||| |||||| |||| |||||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
4967811 |
gggattgagggagtagtttattcgtttgtaatcagtgtgctactatcctgaacaagaattattccacttagaaattgaattgaatttagattcttccaaa |
4967910 |
T |
|
| Q |
349 |
tcatttctcttttaagaataat |
370 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
4967911 |
tcatttctc-tttaagaataat |
4967931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 88 - 172
Target Start/End: Original strand, 4967640 - 4967724
Alignment:
| Q |
88 |
tattctaatgatcataaatgcaagtgagataacaataaattggaatttgaaagtgatgcacttatcatgtacattttctggtcac |
172 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4967640 |
tattctgatgatcataaatgcaagtgagataacaataaattggaatttgaaagtgatgcacttatcatgtacattttccggtcac |
4967724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University