View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11020_low_5 (Length: 224)
Name: NF11020_low_5
Description: NF11020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11020_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 18640888 - 18640669
Alignment:
| Q |
1 |
caatctcttcaacaa-----aaaccattgcattaaccattcataattcaatggcttttcctctatgcaatctcaatctcaatctttctctattacctcaa |
95 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18640888 |
caatctcttcaacaaaaaataaaccattgcattaaccattcaaaattcaatggcttttcctctatgcaatctcaatctcaatctttctctattacctcaa |
18640789 |
T |
|
| Q |
96 |
tccaaatcaagattcaaacacaaaccctttcaccaatcactttcttcttcaaaacccatttctcaatgctctttattcttca---cttcttcttcagtcg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18640788 |
tccaaatcaagattcaaacacaaaccctttcaccaatcactttcttcttcaaaacccatttctcaatgctctttattcttcacttcttcttcttcagtcg |
18640689 |
T |
|
| Q |
193 |
aaagtttcactgcacaggtt |
212 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
18640688 |
aaagtttcactgcacaggtt |
18640669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University