View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11021_high_3 (Length: 216)

Name: NF11021_high_3
Description: NF11021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11021_high_3
NF11021_high_3
[»] chr2 (1 HSPs)
chr2 (49-200)||(17265810-17265958)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 49 - 200
Target Start/End: Original strand, 17265810 - 17265958
Alignment:
49 gtgatcacgtgtgttgataactatttcgttgttcttgttatggatgatccccataataaagatttccagtatcttagtaacagtccctaccatgagcttt 148  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||    
17265810 gtgatcacgtgtgttgataactatttcgttgttcttgttatggatgatccccatat---agatttccagtatcttagtaacagtccctaccatgagcttt 17265906  T
149 tctattctctctttctcattttccactgcaatgcagggtactgccttctttc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||    
17265907 tctattctctctttctcattttccactgcaatgcagggtactgccttgtttc 17265958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University