View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11021_low_5 (Length: 242)
Name: NF11021_low_5
Description: NF11021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11021_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 33512684 - 33512891
Alignment:
| Q |
18 |
gataacacaaatatcattaaggtattgtataatttaagannnnnnnnngtataatttctggtaagtccaaaatgttatgcacacggtgaaagcatggtgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33512684 |
gataacacaaatatcattaaggtattgtataatttaagatttttttttgtataatttctggtaagtccaaaatgttatgcacacggtgaaagcatggtgc |
33512783 |
T |
|
| Q |
118 |
ggttattgcgtgtcttttagttttctatattttgtcacataatggaaaattagtgtttcatcattttcattatactctctctttgttagtgcgtatcttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33512784 |
ggttattgcgtgtcttttagttttctatattttgtcacataatgg--aattagtgtttcatcattttcattatactctctctttgttagtgcgtatcttt |
33512881 |
T |
|
| Q |
218 |
tttactcctt |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
33512882 |
tttactcctt |
33512891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University