View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11022_low_25 (Length: 299)
Name: NF11022_low_25
Description: NF11022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11022_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 46 - 269
Target Start/End: Original strand, 38972528 - 38972751
Alignment:
| Q |
46 |
aggagataagcaataataggcaacaaaatctcatcaagagttttaatgttattgtatttttaggacatgaatttggaattcacaaactt-tgattaagct |
144 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38972528 |
aggagataagcaataataggcaacaaa-tctcatcaagagttttaatgttattgtatttttaggacatgaatttggaattcacaaacttgtgattaagct |
38972626 |
T |
 |
| Q |
145 |
aatgaagacctgaaccatatcattcaagtggcactgaaatatcaactagctaatatgatccacccacttgaataattataatcaatgatagtgaaagtgt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38972627 |
aatgaagacctgaaccatatcattcaagtggcagtgaaatatcaactagctagtatgatccacccacttgaataattataatcaatgatagtgaaagtgt |
38972726 |
T |
 |
| Q |
245 |
gatgtctcattgaaatagtttatat |
269 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38972727 |
gatgtctcattgaaatagtttatat |
38972751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University