View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11022_low_33 (Length: 210)
Name: NF11022_low_33
Description: NF11022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11022_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 190
Target Start/End: Original strand, 42512273 - 42512449
Alignment:
| Q |
14 |
tagcataggagttggagcccaaatttttttgggtaaaatgtttttataccatataagatacacaagnnnnnnnnnnnaaggaaagttacacaagttttca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42512273 |
tagcataggagttggagcccaaatttttttgggtaaaatgtttttataccacataagatacacaagtttttttttttaaggaaagttacacaagttttca |
42512372 |
T |
 |
| Q |
114 |
aatcgtggaaatttcttgcaatagaattatagaagggtgtccaagttcattgaattaatgtagcctgaattctgatc |
190 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42512373 |
aatcgtggaaatttcttgcaatagaactatagaagggtgtccaagttcattgcattaatgtagcctgaattctgatc |
42512449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University