View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11024_low_6 (Length: 240)
Name: NF11024_low_6
Description: NF11024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11024_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 41228223 - 41228450
Alignment:
| Q |
1 |
tatggtttcaatatcaataagaataatcttttgcctttagttttatgtaaaa-atagtatctatccttttatgaataaactgaatttggttcaagcttta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41228223 |
tatggtttcaatatcaataagaataatcttttgcctttagttttatgtaaaaaatagtatctatccttctatgaataaactgaatttggttcaagcttta |
41228322 |
T |
 |
| Q |
100 |
tggcttagttcaaatcaattaatattgttcacgt-ctctctatataaagaaaattatgtttttcttgattatattctga-nnnnnnngttttgtgaaatc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41228323 |
tggcttagttcaaatcaattaatattgttcacgtcctctctatataaagaaagttatgtttttcttgattatattctgattttttttgttttgtgaaatc |
41228422 |
T |
 |
| Q |
198 |
tcaaggttggcatttaaaacaacaattt |
225 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
41228423 |
tcagggttggcatttaaaacaacaattt |
41228450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 42783538 - 42783756
Alignment:
| Q |
1 |
tatggtttcaatatcaataagaataatcttttgcctttagttttatgtaaaaatagtatctatccttttatgaataaactgaatttggttcaagctttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42783538 |
tatggtttcaatatcaataagaataatcttttgcctttagttttatgtaaaaatagtatctatgcttttatgaataaactgaatttggttcaagctttat |
42783637 |
T |
 |
| Q |
101 |
ggct--tagttcaaatcaattaatattgttcacgt-ctctctatataaagaaaattatgtttttcttga-ttatattctgannnnnnngttttgtgaaat |
196 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| |||||| |||||||||| |||||||||| |||| | ||||||||| | ||||||||| |
|
|
| T |
42783638 |
ggcttatagttcaaatcaattaatcttgttcacgtcctctctctataaagaaagttatgtttttgttgagtaatattctga--tttttgccttgtgaaat |
42783735 |
T |
 |
| Q |
197 |
ctcaaggttggcatttaaaac |
217 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42783736 |
ctcaaggttggcatttaaaac |
42783756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 27173152 - 27173084
Alignment:
| Q |
5 |
gtttcaatatcaataagaataatcttttgcctttag-ttttatgtaaaaatagtatctatccttttatg |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||| |
|
|
| T |
27173152 |
gtttcaatatcaataagaataatcttttgcctttagtttttatgtaaaggtagtatctatacttttatg |
27173084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 70 - 134
Target Start/End: Original strand, 32643410 - 32643474
Alignment:
| Q |
70 |
atgaataaactgaatttggttcaagctttatggcttagttcaaatcaattaatattgttcacgtc |
134 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||| || |||||||| |
|
|
| T |
32643410 |
atgaataaactgaatgtggttcaagctttatggtttagttcaaatcaattaatcttcttcacgtc |
32643474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 32643295 - 32643357
Alignment:
| Q |
1 |
tatggtttcaatatcaataagaataatcttttgcctttagttttatgtaaaaatagtatctat |
63 |
Q |
| |
|
||||||||| |||||||| |||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32643295 |
tatggtttcgatatcaattagaatattcttttgcttttagttttatgtaaaaatagtatctat |
32643357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 114
Target Start/End: Complemental strand, 27173040 - 27172996
Alignment:
| Q |
70 |
atgaataaactgaatttggttcaagctttatggcttagttcaaat |
114 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
27173040 |
atgaataaactgaatgtggtttaagctttatggcttagttcaaat |
27172996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 51874444 - 51874406
Alignment:
| Q |
1 |
tatggtttcaatatcaataagaataatcttttgccttta |
39 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51874444 |
tatggtttcaatatcaactagaataatcttttgccttta |
51874406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 88 - 125
Target Start/End: Original strand, 42447058 - 42447095
Alignment:
| Q |
88 |
gttcaagctttatggcttagttcaaatcaattaatatt |
125 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
42447058 |
gttcaagcttgatgacttagttcaaatcaattaatatt |
42447095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University