View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11025_high_10 (Length: 333)
Name: NF11025_high_10
Description: NF11025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11025_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 317
Target Start/End: Complemental strand, 33996827 - 33996520
Alignment:
| Q |
1 |
actgtacggatataaacatgtgcatgcataaataaattggattaagtcaaaaggcttgaagatgtaattagaacttatatcattgaatcaaacgggttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
33996827 |
actgtacggatataaacatgtgcatgcataaat----tggattaagtcaaaaggcttgaagatgtaattag---ttatatcatcgaatcaaaagggttaa |
33996735 |
T |
 |
| Q |
101 |
gtaggaggctataacgcatgcatcatgcatgtaaatgtaaactagctaatgcatccgaatagggttaaatgaatatttatatgcattattgacaaaaaga |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33996734 |
gttagaggctataacgcatgcatcatgcatgtaaa------ctaggtaatgcatccgaatagggttaaatgaatatttatatgcattattgacaaaaaga |
33996641 |
T |
 |
| Q |
201 |
atatttatct----gcattgtcacatttaatacatttgtttgagtattcaaatacatgaagatctgggtgcatacattcacttcagctaatatagaaagc |
296 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
33996640 |
atatttatctacatgcattgtcacatttaatacatttgtttgaatattaaaatacatgaaaatctgggtgaatacatccacttcagctaatatagaaagc |
33996541 |
T |
 |
| Q |
297 |
aacgactatgtaccaaaaaac |
317 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33996540 |
aacgactatgtaccaaaaaac |
33996520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University