View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11025_high_17 (Length: 281)
Name: NF11025_high_17
Description: NF11025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11025_high_17 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 22 - 124
Target Start/End: Complemental strand, 12754961 - 12754859
Alignment:
| Q |
22 |
tttgatctgggttgcctgtgattttgtattagtaattgtatctgtgttgtgttagtgttatctaccgatacttgttagacaccagacacacctttaatat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12754961 |
tttgatctgggttgcctgtgattttgtattagtaattgtatctgtgttgtgttagtgttatctaccgatacttgttagacaccagacacacctttaatat |
12754862 |
T |
 |
| Q |
122 |
caa |
124 |
Q |
| |
|
||| |
|
|
| T |
12754861 |
caa |
12754859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 22 - 117
Target Start/End: Complemental strand, 12817922 - 12817827
Alignment:
| Q |
22 |
tttgatctgggttgcctgtgattttgtattagtaattgtatctgtgttgtgttagtgttatctaccgatacttgttagacaccagacacaccttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12817922 |
tttgatctgggttgcctgtgattttgtattagtaattgtatctgtgttgtgttagtgttatctaccgatacttgttagacaccagacacaccttta |
12817827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 12754797 - 12754702
Alignment:
| Q |
186 |
caacagggagctgggcttgctaaccttggtaacacatgctttctcaattcaattatgcaatgcttcacgcataccgtgcccctagttgagggtctt |
281 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12754797 |
caacagggagctgggcttgccaaccttggtaacacatgctttctcaattcaattatgcaatgcttcacgcataccgtgcccctagttgagggtctt |
12754702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 12817759 - 12817664
Alignment:
| Q |
186 |
caacagggagctgggcttgctaaccttggtaacacatgctttctcaattcaattatgcaatgcttcacgcataccgtgcccctagttgagggtctt |
281 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12817759 |
caacagggagctgggcttgccaaccttggtaacacatgctttctcaattcaattatgcaatgcttcacgcataccgtgcccctagttgagggtctt |
12817664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 195 - 281
Target Start/End: Original strand, 7773045 - 7773131
Alignment:
| Q |
195 |
gctgggcttgctaaccttggtaacacatgctttctcaattcaattatgcaatgcttcacgcataccgtgcccctagttgagggtctt |
281 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| ||||| ||||| || |||||| |
|
|
| T |
7773045 |
gctggacttgctaaccttggtaacacatgctttctcaattcaatcatgcaatgcttcaatcatacagtgcctctagtcgaaggtctt |
7773131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 195 - 281
Target Start/End: Original strand, 7766910 - 7766996
Alignment:
| Q |
195 |
gctgggcttgctaaccttggtaacacatgctttctcaattcaattatgcaatgcttcacgcataccgtgcccctagttgagggtctt |
281 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||| || ||||||||||||| ||||| ||||| ||||| || |||||| |
|
|
| T |
7766910 |
gctggacttgccaaccttggtaacacatgctttctcaattcgatcatgcaatgcttcattcatacggtgcctctagtcgaaggtctt |
7766996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 207 - 281
Target Start/End: Original strand, 7777892 - 7777966
Alignment:
| Q |
207 |
aaccttggtaacacatgctttctcaattcaattatgcaatgcttcacgcataccgtgcccctagttgagggtctt |
281 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||| ||||| ||||| ||||| || |||||| |
|
|
| T |
7777892 |
aaccttggtaacacatgctttctcaattcgatcatgcaatgcttcactcatacagtgcctctagtcgaaggtctt |
7777966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University