View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11025_high_29 (Length: 202)

Name: NF11025_high_29
Description: NF11025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11025_high_29
NF11025_high_29
[»] chr8 (2 HSPs)
chr8 (1-191)||(42764903-42765093)
chr8 (1-42)||(42764861-42764902)


Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 42764903 - 42765093
Alignment:
1 agattataaaaaatgctatatttattaacggcatgaattatatcatgtccaggcttggtgccgtgatgtgtatgggagtaacggctggtgcttatatcct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42764903 agattataaaaaatgctatatttattaacggcatgaattatatcatgtccaggcttggtgccgtgatgtgtatgggagtaacggctggtgcttatatcct 42765002  T
101 tactctttttgcagtatgtacccttttaactttgatggaaacaaaatattggaaataactgcgttagtcaactttttattgatttgttctt 191  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
42765003 tactctttttgcagtatgtacccttttaactttgatggaaagaaaatattggaaataactgcgttagtcaactttttattgatttgttctt 42765093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 42764861 - 42764902
Alignment:
1 agattataaaaaatgctatatttattaacggcatgaattata 42  Q
    |||||||||||||||||||||||||||| |||||||||||||    
42764861 agattataaaaaatgctatatttattaatggcatgaattata 42764902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University