View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11025_low_16 (Length: 286)

Name: NF11025_low_16
Description: NF11025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11025_low_16
NF11025_low_16
[»] chr8 (3 HSPs)
chr8 (153-262)||(7034991-7035100)
chr8 (1-95)||(7035151-7035245)
chr8 (46-87)||(7028415-7028456)


Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 153 - 262
Target Start/End: Complemental strand, 7035100 - 7034991
Alignment:
153 gactttaaattatagctgcattcaacaagctagatatcagattaagccctgttgatgacttgactaatgagtaccgacttagtccagtcaatattacagt 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7035100 gactttaaattatagctgcattcaacaagctagatatcagattaagccctgttgatgacttgactaatgagtaccgacttagtccagtcaatattacagt 7035001  T
253 tatgttgcta 262  Q
    ||||||||||    
7035000 tatgttgcta 7034991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 7035245 - 7035151
Alignment:
1 atctgaggaacagggctggaactagtaggagaaaatatcagcataaagagagtgagataaacaaataaacttatgctactactggatatctgcat 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
7035245 atctgaggaacagggctggaactagtaggagaaaatatcagcataaagagagtgagataaacaaataaacttatgctactacaggatatctgcat 7035151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 87
Target Start/End: Complemental strand, 7028456 - 7028415
Alignment:
46 aagagagtgagataaacaaataaacttatgctactactggat 87  Q
    |||||||||||||||| ||| |||||||||||||||||||||    
7028456 aagagagtgagataaagaaacaaacttatgctactactggat 7028415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University