View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11025_low_21 (Length: 248)
Name: NF11025_low_21
Description: NF11025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11025_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 65 - 180
Target Start/End: Original strand, 42037456 - 42037571
Alignment:
| Q |
65 |
taattaagaaccctaacctcaattgcacagagaaagaaaatgcttggttcaccaataactattagcactctatttaattttagtgtttgtatgtgtgcct |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42037456 |
taattaagaaccctaacctcaattgcacagagaaagaaaatacttggttcaccaataactattagcactctatttaattttagtgtttgtatgtgtgcct |
42037555 |
T |
 |
| Q |
165 |
gtgtgaaaccagagat |
180 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42037556 |
gtgtgaaaccagagat |
42037571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University