View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11025_low_25 (Length: 228)
Name: NF11025_low_25
Description: NF11025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11025_low_25 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 32 - 228
Target Start/End: Original strand, 39502668 - 39502864
Alignment:
| Q |
32 |
agtcaaataaagggagttgtaagttgtaacctcaaacctcaacaggcatttcaaatctccccggaacagttgaaaaatgactacatgtaaaacatttcta |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39502668 |
agtcaaataaagggagttgtaagttgtaacctcaaacctcaacagacatttcaaatctccccggagcagttgaaaaatgactacatgtaaaacatttcta |
39502767 |
T |
 |
| Q |
132 |
catatcatactcaagcctttgataaatttatagacnnnnnnnnnnnggcaaaatacaagaaagaaagaaagaacaggcatcaacaaaattgagataa |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39502768 |
catatcatactcaagcctttgataaatttatagaccaaaaaaaaaaggcaaaatacaagaaagaaagaaagaacaggcatcaacaaaattgagataa |
39502864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University