View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11025_low_28 (Length: 216)
Name: NF11025_low_28
Description: NF11025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11025_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 181
Target Start/End: Complemental strand, 2703725 - 2703694
Alignment:
| Q |
150 |
aaggatacacatatttcgaccattacaccctc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2703725 |
aaggatacacatatttcgaccattacaccctc |
2703694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 36
Target Start/End: Complemental strand, 5996689 - 5996655
Alignment:
| Q |
2 |
tagttgtacaaatatcatttctcgttaaattaaat |
36 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5996689 |
tagttgtacaaatatcatttctctttaaattaaat |
5996655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University