View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11025_low_30 (Length: 202)
Name: NF11025_low_30
Description: NF11025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11025_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 42764903 - 42765093
Alignment:
| Q |
1 |
agattataaaaaatgctatatttattaacggcatgaattatatcatgtccaggcttggtgccgtgatgtgtatgggagtaacggctggtgcttatatcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42764903 |
agattataaaaaatgctatatttattaacggcatgaattatatcatgtccaggcttggtgccgtgatgtgtatgggagtaacggctggtgcttatatcct |
42765002 |
T |
 |
| Q |
101 |
tactctttttgcagtatgtacccttttaactttgatggaaacaaaatattggaaataactgcgttagtcaactttttattgatttgttctt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42765003 |
tactctttttgcagtatgtacccttttaactttgatggaaagaaaatattggaaataactgcgttagtcaactttttattgatttgttctt |
42765093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 42764861 - 42764902
Alignment:
| Q |
1 |
agattataaaaaatgctatatttattaacggcatgaattata |
42 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42764861 |
agattataaaaaatgctatatttattaatggcatgaattata |
42764902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University