View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11026_low_6 (Length: 228)
Name: NF11026_low_6
Description: NF11026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11026_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 28550016 - 28550219
Alignment:
| Q |
19 |
tgttttgcaagcttgctttacggttatgttttcaattcatatcgcattcgaaaagggtggaatattaatagcaaattaatggctttaataggagttaatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550016 |
tgttttgcaagcttgctttacggttatgttttcaactcatattgcattcgaaaagggtggaatgttaatagcaaattaatggctttaataggagttaatt |
28550115 |
T |
|
| Q |
119 |
ttatgcaaaaattacacgccgccatctcactttccatcgttgaggtattcctgattttagtgaacctaagtaatgtggcacatcttcaatgtttgcctat |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550116 |
ttatgcaaaaattacacgctgccatctcactttccatcgttgaggtattcctgattttagtgaacctaagtaatgtggcacatcttcaatgtttgcctat |
28550215 |
T |
|
| Q |
219 |
gctt |
222 |
Q |
| |
|
|||| |
|
|
| T |
28550216 |
gctt |
28550219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University