View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11027_high_8 (Length: 417)
Name: NF11027_high_8
Description: NF11027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11027_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 235 - 400
Target Start/End: Original strand, 23964945 - 23965110
Alignment:
| Q |
235 |
gcagatatataatcggtaattatatagtcttagaggcttattaaacatggtatgttgcattttattttattttgaatttcaattcttgatttataggata |
334 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23964945 |
gcagatatataatcggttattatatagtcttagaggcttattaaacatggtatgttgcattttattttattttgaatttcaattcttgatttataggata |
23965044 |
T |
 |
| Q |
335 |
attcaatgcttagttgttgttttataatgaatgttgatatctcccggttttaatgaaattatgtgt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23965045 |
attcaatgcttagttgttgttttataatgaatgttgatatctcccggttttaatgaaattatgtgt |
23965110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 84 - 167
Target Start/End: Original strand, 23964794 - 23964877
Alignment:
| Q |
84 |
ctgagagaagtcgagattagtgaaaggttaacctcatgtttagttttatgagagtcttacctatgttactttaaacgtcgcgtc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23964794 |
ctgagagaagtcgagattagtgaaaggttaacctcatgtttagttttatgagagtcttacctatgttactttaaacgtcgcgtc |
23964877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University