View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11027_high_9 (Length: 388)
Name: NF11027_high_9
Description: NF11027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11027_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 12 - 370
Target Start/End: Complemental strand, 41550832 - 41550474
Alignment:
| Q |
12 |
gatgaagatgaaagagttcgcgaagcatgaccgtgactccacgagaatcgccgtagctcctgcgagaattgctttgccttagcaaccgcctctgctttca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41550832 |
gatgaagatgaaagagttcgcgaagcatgaccgtgactccacgagaatcgccgtagctcctgcgagaattgctttgccttagcaaccgcctctgctttca |
41550733 |
T |
|
| Q |
112 |
gctcctgtgagaaatgccggaatcctctcgaggagcttctccgcatcgacggtgaccgtggaacagacaccggagtatcgtaaccgcttccggcgacgga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41550732 |
gctcctgtgagaaatgccggaatcctctcgaggagcttctccgcatcgacggtgaccgtggaacagacaccggagtatcgtaaccgcttccggcgacgga |
41550633 |
T |
|
| Q |
212 |
ggaatcgtcgatattaataacagctggctcaacactacgaagaacgattgtatcatcatctcgaagatcaagcgtaacctccacaaattcatcaccggtg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41550632 |
ggaatcgtcgatattaataacagctggctcaacactacgaagaacgattgtatcatcgtctcgaagatcaagcgtaacctccacaaattcatcaccggtg |
41550533 |
T |
|
| Q |
312 |
tagcttgactccgttcccggcgaagtaccggcgctgacagttgcttttccgggaacact |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41550532 |
tagcttgactccgttcccggcgaagtaccggcgctgacagttgcttttccgggaacact |
41550474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University