View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11027_low_16 (Length: 239)
Name: NF11027_low_16
Description: NF11027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11027_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 122 - 223
Target Start/End: Original strand, 29338171 - 29338272
Alignment:
| Q |
122 |
atgaaagcaaacatctggtactgttacatgtacaaaaagttcaaatcatcatcaactaggttgattgaacatagtatgagaaaaaagcaaacacaagcta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29338171 |
atgaaagcaaacatctggtactgttacatgtacaaaaagttcaaatcatcatcaactaggttgattgaacatagtatgagaaaaaagcaaacacaagcta |
29338270 |
T |
 |
| Q |
222 |
ac |
223 |
Q |
| |
|
|| |
|
|
| T |
29338271 |
ac |
29338272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 29338049 - 29338129
Alignment:
| Q |
1 |
tgacaataataacagtagaaaacagtgagaagatatgatgaaatatgctattcttttcaatgtctgtggcattgtaccacc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29338049 |
tgacaataataacagtagaaaacagtgagaagatatgatgaaatatgctattcttttcaatgtctgtggcattgtaccacc |
29338129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University