View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11028_high_10 (Length: 219)
Name: NF11028_high_10
Description: NF11028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11028_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 11751748 - 11751940
Alignment:
| Q |
19 |
atacagctgatactatcaaaaacagcttcaatgtcgtggctgttcatcctcaagacaggatggttcgctggaatagttttaatcacagttgtcatgtgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11751748 |
atacagctgatactatcaaaaacagcttcaatgtcgtggctgttcatcctcaagacaggatggttcgctggaatagttttaatcacagttgtcatgtgct |
11751847 |
T |
|
| Q |
119 |
aaatgtggagagtggctgtctaggagtgccaattcgagctggttatgtaggtgttattcgaaattctacagggttctatctctctgcttctcc |
211 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| | |||||| |
|
|
| T |
11751848 |
aaatgtggatagtagctgtctaggagtgccaattcgagctggttatgtaggtgttattcgatattttacagggttctatctctcgggttctcc |
11751940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 108 - 202
Target Start/End: Complemental strand, 7446274 - 7446180
Alignment:
| Q |
108 |
tgtcatgtgctaaatgtggagagtggctgtctaggagtgccaattcgagctggttatgtaggtgttattcgaaattctacagggttctatctctc |
202 |
Q |
| |
|
||||||||||| |||||||| || | ||| |||| ||||| ||||||||||||| || || |||||||| |||||| |||| ||||||||||| |
|
|
| T |
7446274 |
tgtcatgtgcttaatgtggacggtagttgtttaggtgtgcccattcgagctggttttggtggagttattcgcaattctgcaggtttctatctctc |
7446180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University