View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11028_high_12 (Length: 209)
Name: NF11028_high_12
Description: NF11028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11028_high_12 |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 121
Target Start/End: Complemental strand, 31889491 - 31889444
Alignment:
| Q |
74 |
cttttgaaatataatcaaaatttacaacaaataatacctattgatcta |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31889491 |
cttttgaaatataatcaaaatttacaacaaataatacctattgatcta |
31889444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 74 - 103
Target Start/End: Complemental strand, 26947495 - 26947466
Alignment:
| Q |
74 |
cttttgaaatataatcaaaatttacaacaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26947495 |
cttttgaaatataatcaaaatttacaacaa |
26947466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 102
Target Start/End: Original strand, 13251005 - 13251033
Alignment:
| Q |
74 |
cttttgaaatataatcaaaatttacaaca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13251005 |
cttttgaaatataatcaaaatttacaaca |
13251033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000004; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 12877822 - 12877857
Alignment:
| Q |
74 |
cttttgaaatataatcaaaatttacaacaaataata |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12877822 |
cttttgaaatatactcaaaatttacaacaaataata |
12877857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 103
Target Start/End: Original strand, 2936663 - 2936691
Alignment:
| Q |
75 |
ttttgaaatataatcaaaatttacaacaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2936663 |
ttttgaaatataatcaaaatttacaacaa |
2936691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 74 - 103
Target Start/End: Original strand, 41279725 - 41279754
Alignment:
| Q |
74 |
cttttgaaatataatcaaaatttacaacaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41279725 |
cttttgaaatataatcaaaatttacaacaa |
41279754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 74 - 103
Target Start/End: Original strand, 25635541 - 25635570
Alignment:
| Q |
74 |
cttttgaaatataatcaaaatttacaacaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25635541 |
cttttgaaatataatcaaaatttacaacaa |
25635570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 102
Target Start/End: Complemental strand, 174099 - 174071
Alignment:
| Q |
74 |
cttttgaaatataatcaaaatttacaaca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
174099 |
cttttgaaatataatcaaaatttacaaca |
174071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 102
Target Start/End: Original strand, 29402464 - 29402492
Alignment:
| Q |
74 |
cttttgaaatataatcaaaatttacaaca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29402464 |
cttttgaaatataatcaaaatttacaaca |
29402492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University