View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11028_high_5 (Length: 329)
Name: NF11028_high_5
Description: NF11028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11028_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 156 - 312
Target Start/End: Original strand, 2945788 - 2945944
Alignment:
| Q |
156 |
aagcagagacataaaaaacatgtggataatttgcaaaatattgatgataaccatcctgcacatcacaaacacagaaaggaacaggacccttctacaggac |
255 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2945788 |
aagcatagacatagaaaacatgtggataatttgcaaaatattgatgataaccatcctgcacatcacaaacacagaaaggaacaggacccttctacaggac |
2945887 |
T |
|
| Q |
256 |
tgatcaaagatctgaggcatgataagataaggcatgcaaattatggaaaacacaaac |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2945888 |
tgatcaaagatctgaggcatgataagataaggcatgcaaattatggaaaacacaaac |
2945944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 11407437 - 11407301
Alignment:
| Q |
18 |
aagccgaggctgaggtggacaaccgatcttcatgaccgttttgtcgacgctgtcacaaagcttggtggccctgacagtatgca---cttctttcatctag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |||||||||||||| |
|
|
| T |
11407437 |
aagccgaggctgaggtggacaaccgatcttcatgaccgttttgtcgacgctgtcacaaagcttggtggccctgatagtatgtacttcttctttcatctag |
11407338 |
T |
|
| Q |
115 |
ttttgttaaagtttttaaattgtagtcgtagttttgt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11407337 |
ttttgttaaagtttttaaattgtagtcgtagttttgt |
11407301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University