View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11029_high_39 (Length: 211)
Name: NF11029_high_39
Description: NF11029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11029_high_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 38263421 - 38263462
Alignment:
| Q |
1 |
ggtatatgctttgaaatctatattcattggccctataaataa |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38263421 |
ggtatatgctttgaaatctatattcattggccctataaataa |
38263462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 106
Target Start/End: Original strand, 38263498 - 38263526
Alignment:
| Q |
78 |
agttgcgaaaagatactctttttgactgt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38263498 |
agttgcgaaaagatactctttttgactgt |
38263526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University