View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11029_low_16 (Length: 307)
Name: NF11029_low_16
Description: NF11029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11029_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 15 - 299
Target Start/End: Original strand, 34078140 - 34078424
Alignment:
| Q |
15 |
aaatatatcacaccaagtaaccaaaataattcatgagttatgtgcataaactccatagcttcttgtggccctgcagatttagaaccaaaatattgttttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34078140 |
aaatatatcacaccaagtaaccaaaataattcatgagttatgtgcataaactccatagcttcttgtggccctgcagatttagaaccaaaatattgttttc |
34078239 |
T |
 |
| Q |
115 |
ctaacaacattctagtgacattgttcattgaaaaagcacccaaaatttctcttaaattaatgggattttcgaaattggcccgtgcaaaaacatctttaac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
34078240 |
ctaacaacattctagtgacattgttcattgaaaaagcacccaaaatttctcttaaattaatgggattttcggatttggcccgtgcaaaaacatctttaac |
34078339 |
T |
 |
| Q |
215 |
aagatgttgtgcttcttcttgacgatgttttgagaaggattcaagtctctttgtagttagtaagtgttccatgcaaattcttctc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34078340 |
aagatgttgtgcttcttcttgacgatgttttgagaaggattcaagtctctttgtagttagtaagtgttccatgcaaattcttctc |
34078424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University