View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11029_low_21 (Length: 289)
Name: NF11029_low_21
Description: NF11029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11029_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 38867341 - 38867619
Alignment:
| Q |
1 |
tgagtcactcagttcatatcagtgattattcattcatcacaatattcaaaattgttggaatatatcaaacaaacaactaataatttctttgatattttgt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38867341 |
tgagtcactcagttcatatcaatgattattcatgcatcacaatattcaaaattgttggaatatatcaaacaaacaactaataatttctttgatattttgt |
38867440 |
T |
 |
| Q |
101 |
cctctaaaaaatgtggaatatatcacatttgttctctaaaaattgaataatcacttagaccttgtttcacccgatgaccaatcaaagtttatcatatccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38867441 |
cctctaaaaaatgtggaatatatcacatttgttctctaaaaattgaataatcacttagaccttgtttcacccgatgaccaatcaaagtttatcatatccc |
38867540 |
T |
 |
| Q |
201 |
caaccaccattccaccctttatatcctccccttgtctggttcgaacaaaatcaaggcaatgatatggtgaatgtctgtg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38867541 |
caaccaccattccaccctttatatcctccccttgtctggttcgaacaaaatcaaggcaatgatatggtgagtgtctgtg |
38867619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 38805707 - 38805639
Alignment:
| Q |
1 |
tgagtcactcagttcatatcagtgattattcattcatcacaatattcaaaattgttggaatatatcaaa |
69 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38805707 |
tgagtcactcagttcacatcaaagattattcatgcattacaatattcaaaattgttggaatatatcaaa |
38805639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University