View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11029_low_25 (Length: 250)
Name: NF11029_low_25
Description: NF11029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11029_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 21483044 - 21482804
Alignment:
| Q |
1 |
caccatgcagacacagagttctcaccagggtcgaagtgcatccgataggagacaggtttgtggacttaagctgtatattattgttagatcatatgttttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |||||||||| |
|
|
| T |
21483044 |
caccatgcagacacagagttctcaccagggtcgaagtgcatccgataggagacaggtttgtggacttcagctttatattattgttagattatatgttttg |
21482945 |
T |
 |
| Q |
101 |
gttgtttatatgatctacgatgtgtgattattagaaatgcatgttaatgcaaaatcatttgttattgaacttgaataagttttaaattatggtcaacaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21482944 |
gttgtttatatgatctacgatgtgtgattattagaaatgcatgtaaatgcaaaatcatttgttattgaacttgaataagttttaaattatggtcaacaac |
21482845 |
T |
 |
| Q |
201 |
cgtaattgtggctgcaatataatggctttaaaggtctctgc |
241 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21482844 |
cgtaattgtggctgcaatataatggttttaaaggtctctgc |
21482804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 21490796 - 21490752
Alignment:
| Q |
178 |
agttttaaattatggtcaacaaccgtaattgtggctgcaatataa |
222 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| |||||| |
|
|
| T |
21490796 |
agttttaaattttggtctgcaaccgtaattgtggctgcgatataa |
21490752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University