View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11029_low_27 (Length: 245)
Name: NF11029_low_27
Description: NF11029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11029_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 36687711 - 36687926
Alignment:
| Q |
19 |
ataattcctataaaagtaaaaataatggaatatgattcaaaactaaatcatattttagaactggaacaaaggaatctttgtctttagatcaattaacaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36687711 |
ataattcctataaaagtaaaaataatggaatatgattcaaaactaaatcatattttagaactggaacaaaggaatctttgtctttagatcaattaacaaa |
36687810 |
T |
|
| Q |
119 |
gaaatagaataataggaacacatgatcgtggatgtgacgccaagttgatggggattctctgaggattgtcaattgtgtaatgtgcatgaataatcagcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36687811 |
gaaatagaataataggaacacatgatcgtggatgtgacgccaagttgatggggattctctgaggattgtcaattgtgtaatgtgcatgaataatcagcaa |
36687910 |
T |
|
| Q |
219 |
aatatattttcccctt |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36687911 |
aatatattttcccctt |
36687926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University