View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11029_low_35 (Length: 229)
Name: NF11029_low_35
Description: NF11029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11029_low_35 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 229
Target Start/End: Original strand, 38324003 - 38324214
Alignment:
| Q |
15 |
gttggactaagggctcccatggtggttgtcgttggtttgaccggaatagtaaaatttaaaaaactttttgtaatcagttggtcattttatcggttgttaa |
114 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38324003 |
gttggactaagggctccgatggt---tgtcgttggtttgaccggaatagtaaaatttaaaaaactttttgtaatcagttggtcattttatcggttgttaa |
38324099 |
T |
 |
| Q |
115 |
aaactttaaattgattgttctgtttattggaaacaagtgttgttgcttctatgtggttggaggttactgataaggcgggcaatggaatgtgtatccaatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38324100 |
aaactttaaattgattgttctgtttattggaaacaagtgttgttgcttctctgtggttggaggttactgataaggcgggcaatggaatgtgtatccaatt |
38324199 |
T |
 |
| Q |
215 |
tggtaaagttttgat |
229 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38324200 |
tggtaaagttttgat |
38324214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University