View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11029_low_37 (Length: 217)

Name: NF11029_low_37
Description: NF11029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11029_low_37
NF11029_low_37
[»] chr1 (2 HSPs)
chr1 (131-210)||(48888425-48888504)
chr1 (1-72)||(48888296-48888367)


Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 131 - 210
Target Start/End: Original strand, 48888425 - 48888504
Alignment:
131 taaggaggaacatgttatgaatttatttgtgctattttagatgttcagtgctgctatttacattctagtttaaattaagt 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
48888425 taaggaggaacatgttatgaatttatttgtgctattttagatgttcagtactgctatttacattctagtttaaattaagt 48888504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 48888296 - 48888367
Alignment:
1 cagaattgtatataagattgcaatgtgaaatcgattctgtactggtttaacattcttgagagcttaatcacc 72  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
48888296 cagaattgtatataagattgcaatgtgaaatcgattctgtactggtttaacattgttgagagcttaatcacc 48888367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University