View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11029_low_40 (Length: 211)

Name: NF11029_low_40
Description: NF11029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11029_low_40
NF11029_low_40
[»] chr8 (2 HSPs)
chr8 (1-42)||(38263421-38263462)
chr8 (78-106)||(38263498-38263526)


Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 38263421 - 38263462
Alignment:
1 ggtatatgctttgaaatctatattcattggccctataaataa 42  Q
    ||||||||||||||||||||||||||||||||||||||||||    
38263421 ggtatatgctttgaaatctatattcattggccctataaataa 38263462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 106
Target Start/End: Original strand, 38263498 - 38263526
Alignment:
78 agttgcgaaaagatactctttttgactgt 106  Q
    |||||||||||||||||||||||||||||    
38263498 agttgcgaaaagatactctttttgactgt 38263526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University