View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11029_low_41 (Length: 207)
Name: NF11029_low_41
Description: NF11029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11029_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 21 - 196
Target Start/End: Complemental strand, 53676141 - 53675957
Alignment:
| Q |
21 |
aaagtgatgactgtaactannnnnnncaagaattgcaaatagtccaacaagctttcctaccaactggaagtaaaa---------ctaaaaataataaagg |
111 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53676141 |
aaagtgatgaatgtaactatttttttcaagaattgcaaatagtccaacaagctttcctaccaactggaagtaaaaaaaaaaaaactaaaaataataaagg |
53676042 |
T |
 |
| Q |
112 |
cacaaaattttgtaaaaaggaggttcatttttggcttatataacaagacaagataaaatgatatacatgcccaccacctttgctt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676041 |
cacaaaattttgtaaaaaggaggttcatttttggcttatataacaagacaagataaaatgatatacatgcccaccacctttgctt |
53675957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University