View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1102_low_10 (Length: 337)
Name: NF1102_low_10
Description: NF1102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1102_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 11183262 - 11183029
Alignment:
| Q |
1 |
ttgataattatatgtcatcatattaataaaactaagtatctttcatttcttgtagtaactcttagatgagatatcatcagtttttactttcttgttcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | || | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11183262 |
ttgataattatatgtcatcatattaataaaactaagtatctttcatat-ttcttgtaactcttagatgagatatcatcagtttttactttcttgttcttt |
11183164 |
T |
|
| Q |
101 |
tct---tttgtgcattcacggggttgtgtcagaaatgttattattttcgtggagtatatacaaggactaggttcaaatcttgtcccctattctagattca |
197 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11183163 |
tctttatttgtgcattcacggggttgtgtcagaaatgttattattttcgt-------------ggactaggttcaaatcttgtcccctattctagattca |
11183077 |
T |
|
| Q |
198 |
aatcttctattgtactcatcaaaacttgatttttattcaagtcttttg |
245 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11183076 |
aatcttctatcgtactcatcaaaacttgatttttattcaagtcttttg |
11183029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University