View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1102_low_12 (Length: 312)
Name: NF1102_low_12
Description: NF1102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1102_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 95 - 221
Target Start/End: Complemental strand, 29820775 - 29820649
Alignment:
| Q |
95 |
attctttattactcatcttgaccaattcttcctaatatcaaatgtcaagcatactcatttgcatgagtttacctgtgttaaaaattcaaaatcacacatg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29820775 |
attctttattactcatcttgaccaattcttcctaatatcaaatgtcaagcatactcatttgcatgagtttacctgtgttaaaaattcaaaatcacacatg |
29820676 |
T |
|
| Q |
195 |
tgttttgctttacctcatatttcatct |
221 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29820675 |
tgttttgctttacctcatatttcatct |
29820649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 115 - 190
Target Start/End: Complemental strand, 29829007 - 29828932
Alignment:
| Q |
115 |
accaattcttcctaatatcaaatgtcaagcatactcatttgcatgagtttacctgtgttaaaaattcaaaatcaca |
190 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| || ||| |||| ||||| || | ||||||||| ||||||||| |
|
|
| T |
29829007 |
accaattctgcctaatatcaaatgtcaagcatattcttttacatgggtttaactttattaaaaattgaaaatcaca |
29828932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 188
Target Start/End: Original strand, 29571408 - 29571445
Alignment:
| Q |
151 |
atttgcatgagtttacctgtgttaaaaattcaaaatca |
188 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
29571408 |
atttgtatgagtttaactgtgttaaaaattcaaaatca |
29571445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University