View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1102_low_14 (Length: 268)
Name: NF1102_low_14
Description: NF1102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1102_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 89 - 258
Target Start/End: Complemental strand, 40383213 - 40383045
Alignment:
| Q |
89 |
agacggagagagtatttgatacatttatatattcnnnnnnntaaattaataatagttatacacaaaaggtacataaaacgatacttcttatgctaaataa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383213 |
agacggagagagtatttgatacatttatatattcaaaaaaataaattaataatagttatacacaaaaggtacataaaacgatacttcttatgctaaataa |
40383114 |
T |
 |
| Q |
189 |
caaagatgcttcctatattagtgataacttgaattattaaaccataaacagacgatactccctatgctac |
258 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
40383113 |
-aaagatgcttcctatgttagtgataacttgaattattaaactataaacagatgatactccctatgctac |
40383045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 12 - 88
Target Start/End: Complemental strand, 28110991 - 28110915
Alignment:
| Q |
12 |
ggctttggtatgctgctgctctgctgttttggctaggagtatatgacagcctcattgctgtcctgcttctttgcacc |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28110991 |
ggctttggtatgctgctgctctgctgttttggctaggagtatatgacagcctcattgctgtcctgcttctttgcacc |
28110915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 12 - 88
Target Start/End: Original strand, 24837258 - 24837334
Alignment:
| Q |
12 |
ggctttggtatgctgctgctctgctgttttggctaggagtatatgacagcctcattgctgtcctgcttctttgcacc |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24837258 |
ggctttggtatgctgctgctctgctgttttggctaggagtatatgacagcctcattgctgtcctgcttctttgcacc |
24837334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 12 - 88
Target Start/End: Original strand, 4028558 - 4028634
Alignment:
| Q |
12 |
ggctttggtatgctgctgctctgctgttttggctaggagtatatgacagcctcattgctgtcctgcttctttgcacc |
88 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
4028558 |
ggctttggtatgctgctgttctgcttttttggctaggagtatatgacggcctcactgctgtcctgcttctttgcacc |
4028634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 12 - 88
Target Start/End: Original strand, 34326482 - 34326558
Alignment:
| Q |
12 |
ggctttggtatgctgctgctctgctgttttggctaggagtatatgacagcctcattgctgtcctgcttctttgcacc |
88 |
Q |
| |
|
|||||||||||||||||| |||| | ||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34326482 |
ggctttggtatgctgctgttctgatttttcggctaggagtatatgacagcctcgctgctgtcctgcttctttgcacc |
34326558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 33 - 78
Target Start/End: Complemental strand, 35052375 - 35052330
Alignment:
| Q |
33 |
tgctgttttggctaggagtatatgacagcctcattgctgtcctgct |
78 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
35052375 |
tgctgttttggctacgagtatatgacagcctcattgttgtcctgct |
35052330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 22793064 - 22793016
Alignment:
| Q |
179 |
tgctaaataacaaagatgcttcctatattagtgataacttgaattattaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||| || ||| |||||||||||||||| |
|
|
| T |
22793064 |
tgctaaataacaaagatgcttcctatgtt--tgaaaacttgaattattaaa |
22793016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University