View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1102_low_17 (Length: 220)
Name: NF1102_low_17
Description: NF1102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1102_low_17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 111 - 220
Target Start/End: Original strand, 39793435 - 39793544
Alignment:
| Q |
111 |
ccctgcaacaggtttgtttctacttcccacaaaaatgggactgagcacaactaaagatcccatcatacgaagtggtaggttgccaagaaaaccctacgat |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
39793435 |
ccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgccaagaaaaacctacaat |
39793534 |
T |
|
| Q |
211 |
taccgccgct |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
39793535 |
taccgccgct |
39793544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University