View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11030_high_13 (Length: 211)
Name: NF11030_high_13
Description: NF11030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11030_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 195
Target Start/End: Original strand, 28587168 - 28587347
Alignment:
| Q |
16 |
tcttcttccaagttttactgtccatgacgggccacctaccgcgaatgatgcatcacgtgctgccacagcaagtatgtccgcgcaagacacaactccggga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28587168 |
tcttcttccaagttttactgtccatgacgggccacctaccgcgaatgatgcatcacgtgctgccacagcaagtatgtccgcgcaagacacaactccggga |
28587267 |
T |
 |
| Q |
116 |
caaactttctcaacctcagattttgctttatcaatgatttcaaatcctcttactgagttaatattaggaagtgcattctt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||| |||| |
|
|
| T |
28587268 |
caaactttctcaacctcagattttgctttatcaatgatttcaaatcctcttactgagttaacatttggacgtgcactctt |
28587347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 59 - 195
Target Start/End: Original strand, 28592397 - 28592533
Alignment:
| Q |
59 |
aatgatgcatcacgtgctgccacagcaagtatgtccgcgcaagacacaactccgggacaaactttctcaacctcagattttgctttatcaatgatttcaa |
158 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28592397 |
aatgatgcatcacgtgctgccacagctagtatgtccgcgcaagacacaactccgggacaaattttctcaacctcagattttgctttatcaatgatttcaa |
28592496 |
T |
 |
| Q |
159 |
atcctcttactgagttaatattaggaagtgcattctt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28592497 |
atcctcttactgagttaatattaggaagtgcattctt |
28592533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 59 - 195
Target Start/End: Complemental strand, 32493807 - 32493671
Alignment:
| Q |
59 |
aatgatgcatcacgtgctgccacagcaagtatgtccgcgcaagacacaactccgggacaaactttctcaacctcagattttgctttatcaatgatttcaa |
158 |
Q |
| |
|
|||||||||||||| ||||| || || | ||||| || |||||||||||||| || || |||||||| || | || ||||||||||||||| | ||||| |
|
|
| T |
32493807 |
aatgatgcatcacgagctgctactgctacgatgtcagcacaagacacaactccagggcatactttctccacattagcttttgctttatcaataacttcaa |
32493708 |
T |
 |
| Q |
159 |
atcctcttactgagttaatattaggaagtgcattctt |
195 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||| |||| |
|
|
| T |
32493707 |
atcctcttacagagttaatatttggaagtgcactctt |
32493671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 59 - 195
Target Start/End: Complemental strand, 28595595 - 28595459
Alignment:
| Q |
59 |
aatgatgcatcacgtgctgccacagcaagtatgtccgcgcaagacacaactccgggacaaactttctcaacctcagattttgctttatcaatgatttcaa |
158 |
Q |
| |
|
||||||||||||||||| || | || | ||||| || |||||||||||||| ||||| |||||||| || |||| ||||||||||||||| | || | |
|
|
| T |
28595595 |
aatgatgcatcacgtgccgctattgctacaatgtcagcacaagacacaactccaggacatactttctctacatcagcttttgctttatcaataacttgga |
28595496 |
T |
 |
| Q |
159 |
atcctcttactgagttaatattaggaagtgcattctt |
195 |
Q |
| |
|
| |||||||| || |||| ||| ||||||||| |||| |
|
|
| T |
28595495 |
aacctcttacagaattaagatttggaagtgcactctt |
28595459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University