View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11030_high_5 (Length: 381)
Name: NF11030_high_5
Description: NF11030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11030_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 12 - 364
Target Start/End: Original strand, 40282890 - 40283244
Alignment:
| Q |
12 |
atgaacatttcatagcatcctggggtgggggatattgcagggtaaaaacagatatacacatctccnnnnnnnnnnnnatcaaaaagttgtttgattgatt |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
40282890 |
atgagcatttcatagcatcctggggtgggggatattgcagggtaaaaacagatatacacagctccttttttgtttttatcaaaaagttgtttgattgatt |
40282989 |
T |
|
| Q |
112 |
aacaagtacatgcaaaacttatcttattcatccacaaagtagttacattatgaaaattccaaggaaaatagactaatagagcaatcttacatacttcata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40282990 |
aacaagtacatgcaaaacttatcttattcatccacaaagtagttacattatgaaaattccaaggaaaatagactaatagagcaatcttacatacttcata |
40283089 |
T |
|
| Q |
212 |
tagttacaa--atgcatttctttataatgacaattggttccttttatttttcatgtacaacaatctcacatgctagcttaattagccttttcattgttgg |
309 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40283090 |
tagttacaaatatgcatttctttataatgacaattggttccctttatttttcatgtacaacaatctcacatgctagcttaattagccttttcattgttgg |
40283189 |
T |
|
| Q |
310 |
ggagtggcgggtccttcatccatccattcaccatatttcacatgcacatacatac |
364 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40283190 |
ggtgtggagggtccttcatccatccattcaccatatttcacatgtacatacatac |
40283244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University