View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11030_low_13 (Length: 273)
Name: NF11030_low_13
Description: NF11030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11030_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 37580129 - 37580314
Alignment:
| Q |
1 |
acacttaagcaatgagaggtcacattaagttgggtccaaacccagtatgcgacaaaatgcgtgtcaaacaaaggaacttcacccatttacacattcaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37580129 |
acacttaagcaatgagaggtcacattaagttgggtccaaacccagtatgcgacaaaatgcgtgtcaaacaaaggaacttcacccatttacacattcaatg |
37580228 |
T |
 |
| Q |
101 |
aacacagcatcatagtttgtcccaaaataaatatgaggattgtgatgttttgagagtgttcgtaacgtttctcttcgcgaaagctc |
186 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
37580229 |
aacacggcatcatagtttgtcccaaaataaatatgaggattgtgatgttttgagagggttcgtaacgtttctcttcgcaaaagctc |
37580314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 190 - 254
Target Start/End: Original strand, 37580340 - 37580404
Alignment:
| Q |
190 |
acatttaattttattgaaagnnnnnnncaagtgtctcattgtttgttgatttgagaattagtttc |
254 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37580340 |
acattcaattttattgaaagaaaaaaacaagtgtctcattgtttgttgatttgagaattagtttc |
37580404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University