View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11031_high_7 (Length: 239)
Name: NF11031_high_7
Description: NF11031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11031_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 30722566 - 30722340
Alignment:
| Q |
1 |
agtagaaatgaaggtgttagttgtataccataacggattcagagttttcgagacaggtaatggattgagattgaaaggggtcgagtgtgaaagggaaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30722566 |
agtagaaatgaaggtgttagttgtataccataacggattcagagttttcgagacaggtaatggattgagattgaaaggggtcgagtgtgaaagggaaggt |
30722467 |
T |
|
| Q |
101 |
ctttgcaggttcttttgtggaagat---aaagaagaaggtggagggtgaacgtagccatgtggatatgaaacatcgtgaacacagtcgtgtagtggttgt |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30722466 |
ctttgcaggttcttttgtggaagatgaagaagaagaaggtggagggtgaacgtagccatgtggatatgagacatcgtgaacacagtcgtgtagtggttgt |
30722367 |
T |
|
| Q |
198 |
tgtgcttggtgggaaggtgatggttct |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30722366 |
tgtgcttggtgggaaggtgatggttct |
30722340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University