View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11032_low_3 (Length: 239)
Name: NF11032_low_3
Description: NF11032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11032_low_3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 30523701 - 30523923
Alignment:
| Q |
17 |
agttagcattttctcttgcataattcagattatgttcattaactgagatactgtttccgatgttcagatagaatgcaaagtatagtaaacataactccag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30523701 |
agttagcattttctcttgcataattcagattatgttcattaactgagatactgtttccgatgttcagatagaatgcaaagtatagtaaacataactccag |
30523800 |
T |
 |
| Q |
117 |
aaaaaagatcaggacttccttcaacagtactttggggaaaaggggttatggaagtaaaagaatgaattgttaggcacacactcaaacaagattttagcca |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30523801 |
aaaaaagatcagaacttccttcaacagtactttggggaaaaggggttatggaagtaaaagaatgaattgttaggcacacactcaaacaagattttagcca |
30523900 |
T |
 |
| Q |
217 |
taatttcaaaaaatgacttcact |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30523901 |
taatttcaaaaaatgacttcact |
30523923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University