View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11033_high_27 (Length: 265)
Name: NF11033_high_27
Description: NF11033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11033_high_27 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 44198923 - 44199187
Alignment:
| Q |
1 |
tcataagctgtaaatttagggaagaaacctacagtcataccattatacagttagaaaatggcaatataaatgaatagaaaacaacagataaaagatcagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44198923 |
tcataagctgtaaatttagggaagaaacctacaatcataccattatacagttagaaaatggcaatataaatgaatagaaaacaacagataaaagatcagg |
44199022 |
T |
|
| Q |
101 |
ccagttacaatgacttttccaccattaatgaacgggatacttgtaaaggattgactagagtgatacctgcacatttggatctttggtttgcatagggatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199023 |
ccagttacaatgacttttccaccattaatgaacgggatacttgtaaaggattgactagagtgatacctgcacatttggatctttggtttgcatagggatc |
44199122 |
T |
|
| Q |
201 |
tgtctccttttgggcaaggtcctttaaataggggttactaaagcaaggaggaggtaaagccctgc |
265 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44199123 |
tgtctccttttgggaaaggtcctttaaataggggttactaaagcaaggaggaggtatagccctgc |
44199187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University