View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11033_high_30 (Length: 254)
Name: NF11033_high_30
Description: NF11033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11033_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 32290516 - 32290742
Alignment:
| Q |
17 |
tgacccacatctccaatccagcaa-gtattcagtggcaaagtagttgcctttcccatttccaacgggttccggtggatcatcatcatcattgtgtcatat |
115 |
Q |
| |
|
|||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32290516 |
tgacccacatctccaa-ccagcaaagcattcagtggcaaagtagttgcctttcccatttccaacgggttccggtggatcatcatcatcattgtgtcatat |
32290614 |
T |
 |
| Q |
116 |
ccttaaaataatagtatcatatatatcactagttaggaagagtatttaatttttgcgtnnnnnnngaaaaggaagagtatttaattttagcaccaacccc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32290615 |
ccttaaaataatagtatcatatatatcactagttaggaagagtatttaatttttgcgtaaaaaaagaaaaggaagagtatttaattttagcaccaacccc |
32290714 |
T |
 |
| Q |
216 |
aactgcatatgtatattttctctttcat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32290715 |
aactgcatatgtatattttctctttcat |
32290742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University