View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11033_high_38 (Length: 214)
Name: NF11033_high_38
Description: NF11033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11033_high_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 104 - 195
Target Start/End: Complemental strand, 1322280 - 1322189
Alignment:
| Q |
104 |
acaataggtctcaatgtaacttttttaatagaagttttggtaggggacaaagaagagagactaaagccgtttatggaagaggtagacattgt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1322280 |
acaataggtctcaatgtaacttttttaatagaagtttttgtaggggacaaagaagagagactaaagccgtttatggaagaggtagacattgt |
1322189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 1322375 - 1322339
Alignment:
| Q |
9 |
gagaagaagatgaagcaaaaacaggcttgtcttgaat |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1322375 |
gagaagaagatgaagcaaaaacaggcttgtcttgaat |
1322339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University