View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11033_low_14 (Length: 372)
Name: NF11033_low_14
Description: NF11033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11033_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 1 - 353
Target Start/End: Original strand, 22269846 - 22270198
Alignment:
| Q |
1 |
cactatactaacacgttgacacagtgttggatgaaagaatttacctggaagcggcagcgaggttcaagagcggagggatcgtgaagcatttgaagaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22269846 |
cactatactaacacgttgacacagtgttggatgaaagaatttacctggaagcggcagcgaggttcaagagcggagggatcgtgaagcatttgaagaataa |
22269945 |
T |
|
| Q |
101 |
gagggcggcgagtacccatctcaacttcacggacattgaagcgaaaaccgaggagtgcttcgagaagggagctctttccatcagattggccaccaacggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22269946 |
gagggcggcgagtacccatctcaacttcacggacattgaagcgaaaaccgaggagtgcttcgagaagggagctctttccatcagattggccaccaacggc |
22270045 |
T |
|
| Q |
201 |
aacaatttcagggatggggagagtctcgccgaaagcgacagcggcggcttggaggcggttgtaagcttcgaagcgagatttggaatcggagtgctttctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22270046 |
aacaatttcagggatggggagagtctcgccgaaagcgacagcggcggcttggaggcggttgtaagcttcgaagcgagatttggaatcggagtgctttctt |
22270145 |
T |
|
| Q |
301 |
gaacgggtggatgtggatggggtctttgtgggagtggtggtggatgacatggt |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22270146 |
gaacgggtggatgtggatggggtctttgtgggagtggtggtggatgacatggt |
22270198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University