View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11033_low_26 (Length: 271)
Name: NF11033_low_26
Description: NF11033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11033_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 8815934 - 8815674
Alignment:
| Q |
1 |
taacctgaggggagtggttagaaattaagttctgaccattttataagcaagtttaaaacagtcatccgtgtttaggttactgttttgctgcaaatacctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8815934 |
taacctgaggggagtggttagaaattaagttctgaccattttataagcaagtttaaaacagtcatccgtgtttaggttactattttgctgcaaatacctc |
8815835 |
T |
|
| Q |
101 |
aaccagacgacaaatcgatttgtgtatgatatttagacttgtgttcacaacttcacattatagcaggacgcaaaaacctctgggtttagattctaaccct |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8815834 |
aaccagatgacaaatcgatttgtgtatgatatttagacttgtgttcacaacttcacattatagcaggacgcgaaaacctctgggtttagattctaaccct |
8815735 |
T |
|
| Q |
201 |
aatgtttttggtaaactaaactatccccttgcacaattgcgaagcttttgtagactctctg |
261 |
Q |
| |
|
||||||||||| |||||||||||||| || | || || |||||||||||||||||||||| |
|
|
| T |
8815734 |
aatgtttttggcaaactaaactatcctctcacgcagttccgaagcttttgtagactctctg |
8815674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University