View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11033_low_34 (Length: 240)

Name: NF11033_low_34
Description: NF11033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11033_low_34
NF11033_low_34
[»] chr1 (2 HSPs)
chr1 (56-223)||(8816436-8816603)
chr1 (1-34)||(8816405-8816438)


Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 56 - 223
Target Start/End: Original strand, 8816436 - 8816603
Alignment:
56 gcagagaagtaaaagtaaaatgcataaaagattgttttctagcatgataaaattgtcaacacaaaccagattatgaaaccaagcgaatttgacggttttt 155  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
8816436 gcagagaagtgaaagtaaaatgcataaaagattgttttctagcatgataaaattgtcaacacaaaccagatcatgaaaccaagcgaatttgacggttttt 8816535  T
156 ccttatcccaaagaagtgaaagaaaattatattaccgaattagcaatatagaaaagcaggatcctatt 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
8816536 ccttatcccaaagaagtgaaagaaaattatattaccgaattagcaatatagaaaagcaggaccctatt 8816603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 8816405 - 8816438
Alignment:
1 caacaacataactgttgatgattacaatatggca 34  Q
    ||||||||||||||||||||||||||||||||||    
8816405 caacaacataactgttgatgattacaatatggca 8816438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University