View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11033_low_34 (Length: 240)
Name: NF11033_low_34
Description: NF11033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11033_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 56 - 223
Target Start/End: Original strand, 8816436 - 8816603
Alignment:
| Q |
56 |
gcagagaagtaaaagtaaaatgcataaaagattgttttctagcatgataaaattgtcaacacaaaccagattatgaaaccaagcgaatttgacggttttt |
155 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8816436 |
gcagagaagtgaaagtaaaatgcataaaagattgttttctagcatgataaaattgtcaacacaaaccagatcatgaaaccaagcgaatttgacggttttt |
8816535 |
T |
 |
| Q |
156 |
ccttatcccaaagaagtgaaagaaaattatattaccgaattagcaatatagaaaagcaggatcctatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8816536 |
ccttatcccaaagaagtgaaagaaaattatattaccgaattagcaatatagaaaagcaggaccctatt |
8816603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 8816405 - 8816438
Alignment:
| Q |
1 |
caacaacataactgttgatgattacaatatggca |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8816405 |
caacaacataactgttgatgattacaatatggca |
8816438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University