View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11033_low_41 (Length: 206)
Name: NF11033_low_41
Description: NF11033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11033_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 19 - 188
Target Start/End: Original strand, 20051642 - 20051809
Alignment:
| Q |
19 |
acacagtttcactaaatcttcccggactttaatgtaatataaaggttaatatataaagattagcagaactacaattgcgatcacaatcacaatttaaaac |
118 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20051642 |
acacagtttcactacatcttcccgcgctttaatgtaatataaaggttaatatataaagattagaagaattacaattgcgatcacaatcacaatttaaaac |
20051741 |
T |
 |
| Q |
119 |
tacgataaagagttttgttcaaatacccctaagccaacagctccaagaccaaacacagcaacacttgaac |
188 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20051742 |
tacgat--agagttttgttcaaatacccctaagccaacagctccaagaccaaacacagcaacacttgaac |
20051809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University